產(chǎn)品名稱(chēng) |
Neurospora sitophila Shear et Dodge, teleomorph |
商品貨號 |
B241479 |
Strain Designations |
NRRL 2884 |
Application |
degrades cellulose produces glucosidase, beta; acid Glucosidase, beta, acid, glucocerebrosidase produces protease nonstructural protein 3 produces single-cell protein SCP produces single-cell protein from cellulose reduces chemical oxygen demand (COD) of potato effluent |
Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format |
freeze-dried |
Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain |
no |
Preceptrol® |
no |
Mating Type |
mating type minus |
Comments |
Impeller-associated shear effects during fermentation
The DNA sequences indicate that this strain is phylogenetically closer to Neurospora intermedia than Neurospora sitophila. |
Morphology |
After 5 days on Neurospora medium at 25°C, colony is low, velutinous, buff-colored. Hyphae hyaline, geniculate. After 2 months, arthroconidia abundant, ellipsoidal or irregularly shaped. |
Medium |
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 331: Neurospora culture agar
|
Growth Conditions |
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACAGAGTTGCAAAACTCCCACAAACCATCGCGAATCTTACCCGTACGGTTGCCTCGGCGCTGGCGGTCCGGAAAGGCCCTCGGGCCCTCCCGGATCCTCGGGTCTCCCGCTCGCGGGAGGCTGCCCGCCGGAGTGCCGAAACTAAACTCTTGATATTTTATGTCTCTCTGAGTAAACTTTTAAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCTCGCCAGTATTCTGGCGAGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCTCTGCTTGCGTTGGGGATCCGCGGCTGTCCGCGGTCCCTCAAAATCAGTGGCGGGCTCGCTAGTCACACCGAGCGTAGTAACTCTACATCGCTATGGTCGTGCGGCGGGTTCTTGCCGTAAAACCCCCCATTTCTAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTTCGGCCCGAGTTGTAATTTGTAGAGGAAGCTTTTGGTGAGGCACCTTCTGAGTCCCCTGGAACGGGGCGCCATAGAGGGTGAGAGCCCCGTATAGTCGGATGCCGATCCAATGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAATTTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGTGACCAGACTTGCGCCGTTCCGATCATCCGGTGTTCTCACCGGTGCACTCGGGACGGCTCAGGCCAGCATCGGTTTTGGCGGGGGGATAAAGGTTCGGGGAACGTAGCTCCTCCGGGAGTGTTATAGCCCCGGGCGTAATGCCCTCGCCGGGACCGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC
|
Name of Depositor |
NRRL |
References |
. . Prog. Biotechnol. 9: 961-964, 1994.
. . Biotechnol. Lett. 14: 863-868, 1992.
. . Resour. Conserv. Recycl. 13: 139-146, 1995.
Beuchat LR, Basha SM. Protease production by the ontjom fungus, Neurospora sitophila. Eur. J. Appl. Microbiol. 2: 195-203, 1976.
Karim MI, Sistrunk WA. Efficiency of selected strains of fungi in reducing chemical oxygen demand in wastewater from steam-peeled potatoes. J. Food Process Preserv. 8: 211-218, 1984.
Oguntimein GB, Moo-Young M. Production and properties of beta-glucosidase by Neurospora sitophila. World J. Microbiol. Biotechnol. 7: 4-11, 1991.
|