產(chǎn)品名稱(chēng) |
Aspergillus fumigatus Fresenius |
商品貨號 |
B235455 |
Strain Designations |
2085 [LSHB] |
Application |
Biomedical Research and Development Material Emerging infectious disease research |
Biosafety Level |
2
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
Product Format |
freeze-dried |
Storage Conditions |
Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
Type Strain |
no |
Preceptrol® |
no |
Comments |
Chitin biosynthesis polyene sensitivity sterol metabolism |
Morphology |
After 5-7 days colonies dark blue-green, consisting of a dense felt of conidiophores, intermingled with aerial hyphae. Conidial heads columnar; conidiogenous cells uniseriate. Conidiophore stipes smooth-walled, often green in the upper part. Vesicles subclavate, 20-30 μm wide. Conidia verrucose, (sub)spherical, 2.5-3.0 μm diam. |
Medium |
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 325: Malt extract agar (Blakeslee's formula)
ATCC® Medium 336: Potato dextrose agar (PDA)
|
Growth Conditions |
Temperature: 24°C to 26°C Atmosphere:
Typical aerobic |
Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence
GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTCTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTTTCGACGGCCGCCGGGGAGGCCTTGCGCCCCCGGGCCCGCGCCCGCCGAAGACCCCAACATGAACGCTGTTCTGAAAGTATGCAGTCTGAGTTGATTATCGTAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGTCCCCCTCTCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCTGCTCTGTAGGCCCGGCCGGCGCCAGCCGACACCCAACTTTATTTTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
D1D2 region of the 28S ribosomal RNA gene
ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCGTTGTAATTTGCAGAGGATGCTTCGGGTGCAGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCTGCGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTTGCGACCAGACTCGCCCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGTGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTATCACCTCTCGGGGTGTCTTATAGCCGAGGGTGCAATGCGGCCTGCCTGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCGTAATGGTCGTAAATGAC
beta-tubulin gene
AGGTGTGTGGATGAAACTCTTGATTTATACTATTTCGGCAACATCTCACGATCTGACTCGCTACTAGGCCAACGGTGACAAATATGTTCCTCGTGCCGTTCTGGTCGATCTCGAGCCTGGTACCATGGACGCTGTCCGTGCCGGTCCCTTCGGCGAGCTATTCCGTCCCGACAACTTCGTCTTCGGCCAGTCCGGTGCTGGTAACAACTGG
|
Name of Depositor |
D Kerridge |
Chain of Custody |
ATCC <-- D Kerridge <-- D. Archer <-- Mycol. Ref. Lab., LSHB |
Isolation |
Clinical isolate |
Cross References |
Nucleotide (GenBank) :
M60301
A.fumigatus small subunit ribosomal RNA.
Nucleotide (GenBank) :
M60300
Aspergillus fumigatus small subunit ribosomal RNA.
Nucleotide (GenBank) :
AF222068
Aspergillus fumigatus cytochrome P450 sterol 14 alpha-demethylase
|
References |
Russel NJ. Polyene sensitivity during germination of conidia of Aspergillus fumigatus. J. Gen. Microbiol. 87: 351-358, 1975.
Archer DB. Chitin biosynthesis in protoplasts and subcellular fractions of Aspergillus fumigatus. Biochem. J. 164: 653-658, 1977. PubMed: 329836
Russell NJ, et al. Sterol metabolism during germination of conidia of Aspergillus fumigatus. J. Gen. Microbiol. 101: 197-206, 1977. PubMed: 336840
Edlind TD, et al. Aspergillus fumigatus CYP51 sequence: potential basis for fluconazole resistance. Med Mycol 39: 299-302, 2001. PubMed: 11446535
Henry T, Iwen PC, Hinrichs SH. Identification of Aspergillus species using internal transcribed spacer regions 1 and 2. J. Clin. Microbiol. 38: 1510-1515, 2000. PubMed: 10747135
|